Advertisement

Increase in acid sphingomyelinase level in human retinal endothelial cells and CD34+ circulating angiogenic cells isolated from diabetic individuals is associated with dysfunctional retinal vasculature and vascular repair process in diabetes

Open AccessPublished:March 29, 2017DOI:https://doi.org/10.1016/j.jacl.2017.03.007

      Highlights

      • Increase of acid sphingomyelinase in diabetes damages retinal vasculature.
      • CD34+ circulating angiogenic cells from diabetic patients with high acid sphingomyelinase have dysfunctional vascular repair.
      • Diabetic individuals showed disrupted diurnal release pattern of CD34+ circulating angiogenic cells.

      Background

      Diabetic retinopathy is a microvascular disease that results from retinal vascular degeneration and defective repair due to diabetes-induced endothelial progenitor dysfunction.

      Objective

      Understanding key molecular factors involved in vascular degeneration and repair is paramount for developing effective diabetic retinopathy treatment strategies. We propose that diabetes-induced activation of acid sphingomyelinase (ASM) plays essential role in retinal endothelial and CD34+ circulating angiogenic cell (CAC) dysfunction in diabetes.

      Methods

      Human retinal endothelial cells (HRECs) isolated from control and diabetic donor tissue and human CD34+ CACs from control and diabetic patients were used in this study. ASM messenger RNA and protein expression were assessed by quantitative polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. To evaluate the effect of diabetes-induced ASM on HRECs and CD34+ CACs function, tube formation, CAC incorporation into endothelial tubes, and diurnal release of CD34+ CACs in diabetic individuals were determined.

      Results

      ASM expression level was significantly increased in HRECs isolated from diabetic compared with control donor tissue, as well as CD34+ CACs and plasma of diabetic patients. A significant decrease in tube area was observed in HRECs from diabetic donors compared with control HRECs. The tube formation deficiency was associated with increased expression of ASM in diabetic HRECs. Moreover, diabetic CD34+ CACs with high ASM showed defective incorporation into endothelial tubes. Diurnal release of CD34+ CACs was disrupted with the rhythmicity lost in diabetic patients.

      Conclusion

      Collectively, these findings support that diabetes-induced ASM upregulation has a marked detrimental effect on both retinal endothelial cells and CACs.

      Keywords

      Introduction

      Diabetic retinopathy (DR) is a microvascular disease that results from diabetes-induced retinal damage that is further exacerbated by bone marrow dysfunction. Bone marrow dysfunction leads to decreased release of cells into the circulation and changes in hematopoiesis resulting in increased circulating proinflammatory monocytes and diminished repair due to defective progenitor cells. Although DR influences all retinal cells, clinical manifestations of DR are mainly due to changes in retinal vessels, where early histologic alterations include pericyte loss, thickening of basement membrane, capillary occlusion, and endothelial cell degeneration.
      • Hammes H.P.
      • Feng Y.
      • Pfister F.
      • Brownlee M.
      Diabetic retinopathy: targeting vasoregression.
      • Lorenzi M.
      • Gerhardinger C.
      Early cellular and molecular changes induced by diabetes in the retina.
      These are followed by break down of blood retinal barrier and leaky vasculature leading to hemorrhages, hard exudates, and retinal edema; structural changes involving the vascular wall leading to microaneurysms; and finally neovascularization, vitreous hemorrhage, and fibrous tissue formation.
      • Wong K.
      Defining diabetic retinopathy severity.
      Impaired vision due to macular edema or vision loss due to neovascularization-induced vitreous hemorrhage or tractional retinal detachment usually takes place in the later stages of the disease.
      Circulating angiogenic cells (CACs), a population of vascular progenitors hematopoietic stem cells (HSCs),
      • Grant M.B.
      • May W.S.
      • Caballero S.
      • et al.
      Adult hematopoietic stem cells provide functional hemangioblast activity during retinal neovascularization.
      are considered as key regulators for healthy maintenance of retinal vasculature. Diabetic metabolic abnormalities lead to defective vascular maintenance due, in part, to failed attempts by dysfunctional CACs to repair damaged endothelium.
      HSCs isolated from bone marrow or CACs from peripheral blood of control (healthy) animals have been shown to repair ischemic damage and aid in reperfusion of ischemic tissues.
      • Grant M.B.
      • May W.S.
      • Caballero S.
      • et al.
      Adult hematopoietic stem cells provide functional hemangioblast activity during retinal neovascularization.
      • Kocher A.A.
      • Schuster M.D.
      • Szabolcs M.J.
      • et al.
      Neovascularization of ischemic myocardium by human bone-marrow-derived angioblasts prevents cardiomyocyte apoptosis, reduces remodeling and improves cardiac function.
      • Kalka C.
      • Masuda H.
      • Takahashi T.
      • et al.
      Transplantation of ex vivo expanded endothelial progenitor cells for therapeutic neovascularization.
      Several studies have shown an association between DR risk and both reduced number
      • Busik J.V.
      • Tikhonenko M.
      • Bhatwadekar A.
      • et al.
      Diabetic retinopathy is associated with bone marrow neuropathy and a depressed peripheral clock.
      • Kusuyama T.
      • Omura T.
      • Nishiya D.
      • et al.
      Effects of treatment for diabetes mellitus on circulating vascular progenitor cells.
      • Fadini G.P.
      • Pucci L.
      • Vanacore R.
      • et al.
      Glucose tolerance is negatively associated with circulating progenitor cell levels.
      • Hazra S.
      • Jarajapu Y.P.R.
      • Stepps V.
      • et al.
      Long-term type 1 diabetes influences haematopoietic stem cells by reducing vascular repair potential and increasing inflammatory monocyte generation in a murine model.
      and function of CACs.
      • Loomans C.J.
      • de Koning E.J.
      • Staal F.J.
      • et al.
      Endothelial progenitor cell dysfunction: a novel concept in the pathogenesis of vascular complications of type 1 diabetes.
      • Loomans C.
      • van Haperen R.
      • Duijs J.M.
      • et al.
      Differentiation of bone marrow-derived endothelial progenitor cells is shifted into a proinflammatory phenotype by hyperglycemia.
      • Caballero S.
      • Sengupta N.
      • Afzal A.
      • et al.
      Ischemic vascular damage can be repaired by healthy, but not diabetic, endothelial progenitor cells.
      • Segal M.S.
      • Shah R.
      • Afzal A.
      • et al.
      Nitric oxide cytoskeletal-induced alterations reverse the endothelial progenitor cell migratory defect associated with diabetes.
      • Tikhonenko M.
      • Lydic T.A.
      • Opreanu M.
      • et al.
      N-3 polyunsaturated fatty acids prevent diabetic retinopathy by inhibition of retinal vascular damage and enhanced endothelial progenitor cell reparative function.
      • Tamarat R.
      • Silvestre J.S.
      • Le Ricousse-Roussanne S.
      • et al.
      Impairment in ischemia-induced neovascularization in diabetes: bone marrow mononuclear cell dysfunction and therapeutic potential of placenta growth factor treatment.
      Several key hyperglycemia- and dyslipidemia-activated pathways leading to retinal endothelial cell and CAC dysfunction have been identified. Prominent among these are pathways that promote an increase of proinflammatory cytokines, proinflammatory lipids, and proangiogenic factors.
      • Kern T.S.
      Contributions of inflammatory processes to the development of the early stages of diabetic retinopathy.
      • Kowluru R.A.
      Role of interleukin-1β in the pathogenesis of diabetic retinopathy.
      • Kowluru R.A.
      • Odenbach S.
      Role of interleukin-1β in the development of retinopathy in rats: effect of antioxidants.
      • Joussen A.M.
      • Poulaki V.
      • Mitsiades N.
      • et al.
      Nonsteroidal anti-inflammatory drugs prevent early diabetic retinopathy via TNF-alpha suppression.
      • Joussen A.M.
      • Doehmen S.
      • Le M.L.
      • et al.
      TNF-alpha mediated apoptosis plays an important role in the development of early diabetic retinopathy and long-term histopathological alterations.
      • Demircan N.
      • Safran B.G.
      • Soylu M.
      • Ozcan A.A.
      • Sizmaz S.
      Determination of vitreous interleukin-1 (IL-1) and tumour necrosis factor (TNF) levels in proliferative diabetic retinopathy.
      • Joussen A.M.
      • Poulaki V.
      • Qin W.
      • et al.
      Retinal vascular endothelial growth factor induces intercellular adhesion molecule-1 and endothelial nitric oxide synthase expression and initiates early diabetic retinal leukocyte adhesion in vivo.
      • Adamiec-Mroczek J.
      • Oficjalska-Młyńczak J.
      Assessment of selected adhesion molecule and proinflammatory cytokine levels in the vitreous body of patients with type 2 diabetes–role of the inflammatory-immune process in the pathogenesis of proliferative diabetic retinopathy.
      • Miyamoto K.
      • Khosrof S.
      • Bursell S.E.
      • et al.
      Prevention of leukostasis and vascular leakage in streptozotocin-induced diabetic retinopathy via intercellular adhesion molecule-1 inhibition.
      • Semeraro F.
      • Cancarini A.
      • Dell’Omo R.
      • Rezzola S.
      • Romano M.R.
      • Costagliola C.
      Diabetic retinopathy: vascular and inflammatory disease.
      We have previously demonstrated activation of the central enzyme of sphingolipid metabolism, acid sphingomyelinase (ASM), as a key metabolic abnormality in diabetic retinal vasculature and CACs. ASM hydrolyzes sphingomyelin into proinflammatory and proapoptotic ceramide. Activation of ASM plays an important role in signal transduction in response to various stimuli including interleukin-1β
      • Liu P.
      • Anderson R.G.
      Compartmentalized production of ceramide at the cell surface.
      • Mathias S.
      • Younes A.
      • Kan C.
      • et al.
      Activation of the sphingomyelin signaling pathway in intact EL4 cells and in a cell-free system by IL-1β.
      and tumor necrosis factor-α.
      • Schutze S.
      • Potthoff K.
      • Machleidt T.
      TNF activates phospholipase sphingomyelin NF-KB by phosphatidylcholine-specific C-induced “acidic” breakdown.
      Endothelial cells represent a major source of ASM.
      • Santana P.
      • Peña L.A.
      • Haimovitz-Friedman A.
      • et al.
      Acid sphingomyelinase-deficient human lymphoblasts and mice are defective in radiation-induced apoptosis.
      • Haimovitz-Friedman A.
      • Cordon-Cardo C.
      • Bayoumy S.
      • et al.
      Lipopolysaccharide induces disseminated endothelial apoptosis requiring ceramide generation.
      • Marathe S.
      • Schissel S.L.
      • Yellin M.J.
      • et al.
      Human vascular endothelial cells are a rich and regulatable source of secretory sphingomyelinase.
      • Opreanu M.
      • Tikhonenko M.
      • Bozack S.
      • et al.
      The unconventional role of acid sphingomyelinase in regulation of retinal microangiopathy in diabetic human and animal models.
      Inhibition of ASM exhibits protective effect in diabetes preventing diabetes-induced retinal inflammation and vascular degeneration.
      • Tikhonenko M.
      • Lydic T.A.
      • Opreanu M.
      • et al.
      N-3 polyunsaturated fatty acids prevent diabetic retinopathy by inhibition of retinal vascular damage and enhanced endothelial progenitor cell reparative function.
      • Opreanu M.
      • Tikhonenko M.
      • Bozack S.
      • et al.
      The unconventional role of acid sphingomyelinase in regulation of retinal microangiopathy in diabetic human and animal models.
      • Chakravarthy H.
      • Navitskaya S.
      • O'Reilly S.
      • et al.
      Role of acid sphingomyelinase in shifting the balance between proinflammatory and reparative bone marrow cells in diabetic retinopathy.
      Previously, we have identified key defects in circadian regulation of CACs. We showed that bone marrow denervation results in loss of circadian release of vascular reparative cells from the bone marrow and generation of increased numbers of proinflammatory cells. Using a rat model of type II diabetes, we showed that the decrease in CACs release from diabetic bone marrow is caused by bone marrow neuropathy and that these changes precede the development of DR. We observed a marked reduction in clock gene expression in the retina and in CACs. Denervation of the bone marrow resulted in progenitors being “trapped” within the bone marrow and in loss of the circadian release of these cells into the circulation. This reduction in the circadian peak of CAC release into the circulation led to diminished reparative capacity and resulted in development of acellular retinal capillaries.
      • Busik J.V.
      • Tikhonenko M.
      • Bhatwadekar A.
      • et al.
      Diabetic retinopathy is associated with bone marrow neuropathy and a depressed peripheral clock.
      We also showed that Per2 mutant mice recapitulate key aspects of diabetes without the associated metabolic abnormalities. In Per2 mutant mice, we observed a 3-fold decrease in proliferation and 50% reduction in nitric oxide levels in CACs. Tyrosine hydroxylase–positive nerve processes and neurofilament-200 staining were reduced in Per2 mutant mice (suggestive of diabetic neuropathy) and increased acellular capillaries were identified.
      • Bhatwadekar A.D.
      • Yan Y.
      • Qi X.
      • et al.
      Per2 mutation recapitulates the vascular phenotype of diabetes in the retina and bone marrow.
      We also showed that as CD34+ CACs acquired differentiation markers (toward the endothelial lineage), robust oscillations of clock genes are observed.
      • Bhatwadekar A.D.
      • Yan Y.
      • Stepps V.
      • et al.
      MiR-92a corrects CD34+ cell dysfunction in diabetes by modulating core circadian genes involved in progenitor differentiation.
      It is well accepted in diabetic complications field that cells isolated from diabetic tissue keep diabetic phenotype for several passages even when cultured in normal glucose. This is due to “metabolic memory,” or “legacy effect” for vascular disease in diabetes—the prolonged benefits of good glycemic control, as well as the prolonged harm of poor control in diabetic patients.
      • Loomans C.J.
      • de Koning E.J.
      • Staal F.J.
      • et al.
      Endothelial progenitor cell dysfunction: a novel concept in the pathogenesis of vascular complications of type 1 diabetes.
      • Roy S.
      • Sala R.
      • Cagliero E.
      • Lorenzi M.
      Overexpression of fibronectin induced by diabetes or high glucose: phenomenon with a memory.
      • Grant M.B.
      • Caballero S.
      • Tarnuzzer R.W.
      • et al.
      Matrix metalloproteinase expression in human retinal microvascular cells.
      • Kowluru R.A.
      • Santos J.M.
      • Mishra M.
      Epigenetic modifications and diabetic retinopathy.
      In this study, we used HREC cells isolated from control and diabetic donor tissue as a model.
      In the present study, we have focused exclusively on human CACs. We asked if the defect in circadian release observed in rodents with diabetes occurred in humans. We examined the effect of diabetes-induced ASM activity on the function of human CACs and retinal endothelial cells comparing the angiogenic ability of control (low ASM) and diabetic (high ASM) HRECs to form tube-like structures in vitro and determining the capacity of control (with low ASM) and diabetic (with high ASM) CACs to support endothelial tube formation.

      Methods

      Circadian study of human CD34+ CACs

      The study was approved by the University of Florida Institutional Review Board #411-2010. All study subjects provided informed consent. Individuals were brought into the Clinical Research Center at the University of Florida for 48 hours. During the first 24 hours, individuals were evaluated, and on the evening of the first day, a heparin lock was inserted into their forearm. During the second 24-hour period, the individuals had 1 mL of blood removed every 2 hours for a total of 24 hours and analyzed for the number of CD34+ cells by flow cytometry. Clinical characteristics of the patients are presented in Table 1.
      Table 1Clinical characteristics of control and diabetic subjects involved in the circadian study
      Subject numberGenderAgeDiabetes durationHbA1cCVDRetinopathyMedications
      Diabetic 1Female67T2D 4 mo7.5NoNoGlucophage
      Diabetic 2Female65T2D 20 y8.8NoNoLantus
      Diabetic 3Male76T2D7.4NoNoGlucophage
      Diabetic 4Female64T2D6.3NoNoActos
      Diabetic 5Female67T2D6.4NoNoGlucophage
      Diabetic 6Female68T2D 9 y6.8NoNoDiabeta
      Diabetic 7Female48T2D6.0NoNoMetformin
      Diabetic 8Female59T2D 10 y7.7NoNoHumulin
      Control 1Female43NoNo
      Control 2Female57NoNo
      Control 3Female68NoNo
      Control 4Male43NoNo
      CVD, cardiovascular disease; HbA1c, hemoglobin A1c; T2D, type II diabetes.
      Inclusion criteria: individuals between the ages of 21 and 65 years were eligible to participate.
      Exclusion criteria: Subjects were excluded for the following reasons: (A) evidence of ongoing acute or chronic infection (HIV, Hepatitis B or C, or tuberculosis); (B) ongoing malignancy; (C) cerebral vascular accident or cerebral vascular procedure; (D) current pregnancy; (E) history of organ transplantation; (F) presence of a graft; (G) uremic symptoms, such as an estimated glomerular filtration rate <20 cc/min (by Modification of Diet in Renal Disease equation), or an albumin <3.6 (to avoid malnutrition as a confounding variable); (H) a history of smoking; and (I) anemia.

      Postmortem imaging of human retina and cell culture

      Primary cultures of HRECs were prepared from postmortem tissue obtained from National Disease Research Interchange, Philadelphia, PA, and Midwest Eye-Banks, Ann Arbor, MI. The tissue was received within 36 hours after death. The donor characteristics are provided in Table 2. Primary HRECs were isolated as previously described.
      • Busik J.V.
      • Mohr S.
      • Grant M.B.
      Hyperglycemia-induced reactive oxygen species toxicity to endothelial cells is dependent on paracrine mediators.
      As previously demonstrated, the cells isolated from control and diabetic donors keep their phenotypes for 4 to 6 passages due to metabolic memory phenomenon.
      • Loomans C.J.
      • de Koning E.J.
      • Staal F.J.
      • et al.
      Endothelial progenitor cell dysfunction: a novel concept in the pathogenesis of vascular complications of type 1 diabetes.
      • Roy S.
      • Sala R.
      • Cagliero E.
      • Lorenzi M.
      Overexpression of fibronectin induced by diabetes or high glucose: phenomenon with a memory.
      • Grant M.B.
      • Caballero S.
      • Tarnuzzer R.W.
      • et al.
      Matrix metalloproteinase expression in human retinal microvascular cells.
      • Kowluru R.A.
      • Santos J.M.
      • Mishra M.
      Epigenetic modifications and diabetic retinopathy.
      On arriving in the laboratory, the eyes were placed on sterile gauze, and they were washed with povidone–iodine solution (Purdue Pharma L.P. Stamford, CT). After 10 minutes, the globe was punctured approximately 2 mm from the limbus, a circumferential incision was made, and the anterior chamber was removed. A vitreous spatula was used to loosen the vitreous adherent to the anterior retina. When all the vitreous was removed, the retina was gently removed from the layer of retinal pigment epithelium and cut at the optic nerve. Before proceeding into the isolation of HRECs, retinas were rinsed, flat mounted, and retinal imaging was taken using a Nikon SMZ-800 Stereo Microscope with Prior Proscan 3 Motorized XY System with Z Drive and MetaMorph Modules to perform image stitching, to properly determine the stage of retinopathy of the donors used for isolation of HRECs. Retinas included in this study have at least 3 signs of nonproliferative DR (NPDR) such as microaneurysms, intraretinal hemorrhages, and intraretinal microvascular abnormalities. Retina was then placed on a 53-μm Nylon mesh filter (Sefar America, Buffalo, NY), washed with a solution containing Glucose (5.5 mM), L-Glutamine (2 mM), and 1× MEM Non-Essential Amino Acids Solution (GIBCO; Life Technologies, Carlsbad, CA). The retinas were then placed into a 25-mL flask containing 100 U/mL of collagenase, type 1 (Worthington Biochemical Co., Lakewood, NJ) in the previously mentioned solution containing 22% bovine serum albumin (Sigma), and 0.01% Soybean Trypsin Inhibitor (Sigma). Retinas were then mechanically agitated using a shaker and allowed to digest at 37°C for approximately 60 minutes or until no tissue fragments could be seen. After digestion, cells were centrifuged at 1000 rpm for 5 minutes. The supernatant was removed, and pellet was suspended in fresh media; 1:1 mix of low-glucose Dulbecco's modified Eagle's medium (1 g/L)/F-12 nutrient mix (GIBCO; Life Technologies, Carlsbad, CA) supplemented with 10% fetal calf serum (Hyclone, Logan, UT), 1% endothelial cell growth supplement (Millipore, MA), 1% insulin–transferrin–sodium selenite media supplement (Sigma) and 1% penicillin–streptomycin antimycotic (GIBCO; Invitrogen-Life Technologies, Carlsbad, CA). Glucose concentration in the final media was adjusted to 5.5 mM. The cells were maintained at 37°C in 95% air and 5% CO2 in a humidified cell culture incubator. Passages 3 to 5 were used in the experiments.
      Table 2Clinical characteristics of control and diabetic HRECs donors and CD34+ CACs subjects involved in the study
      HRECs donor numberGenderAgeDiabetes durationCVDRetinopathyNephropathyNeuropathyMedications
      Diabetic 1Male71T2D 18 yYesModerate NPDRYesNoInsulin
      Diabetic 2Male66T2D 16 yYesSevere NPDRYesNoInsulin Humalog and Humulin-N
      Diabetic 3Female50T2D 15 yNoSevere NPDRNoNoInsulin
      Diabetic 4Male73T2D 6 yYesMild NPDRYesYesInsulin
      Diabetic 5Male71T2D 20 yYesModerate NPDRYesNoInsulin
      Diabetic 6Male62T2D 22 yYesMild NPDRYesNoInsulin
      Diabetic 7Male70T2D 15 yYesModerate NPDRYesNoInsulin
      Control 1Female58NoNoNoNoNo
      Control 2Male56NoYesNoNoNo
      Control 3Male71NoNoNoNoNo
      Control 4Female52NoNoNoNoNo
      CD34+ CACs subject numberGenderAgeDiabetes durationHbA1CCVDRetinopathyNephropathyNeuropathy
      Diabetic 1Male55T2D 10 y14NoSevere NPDRNoNo
      Diabetic 2Female58T2D6.5NoModerate NPDRNoNo
      Diabetic 3Female59T2D7.1NoModerate NPDRNoNo
      Diabetic 4Male41T2D14NoPDRNoNo
      Control 1Female57NoNoNoNoNo
      Control 2Male49NoNoNoNoNo
      Control 3Female39NoNoNoNoNo
      Control 4Female58NoNoNoNoNo
      CACs, circulating angiogenic cells; CVD, cardiovascular disease; HbA1c, hemoglobin A1c; HRECs, human retinal endothelial cells; NPDR, nonproliferative diabetic retinopathy; T2D, type II diabetes.

      Human CD34+ CACs isolation

      Human peripheral blood samples (150 mL) were collected into sodium citrate–containing CPTTM glass vacuum tubes (BD, Franklin Lakes, NJ). Written informed consent was obtained from each patient, and all procedures were approved by the Institutional Review Board at the University of Florida (IRB # 408-2010). Peripheral blood mononuclear cells were isolated from the blood by density gradient centrifugation using Lympholyte (Cedarlane Laboratories Ltd, ON, Canada). The CD34+ cell fraction was then isolated from the mononuclear cells using the EasySep CD34+ positive selection system according to the manufacturer's instructions (Stem Cell Technologies, Vancouver, BC, Canada). Clinical characteristics of the patients are presented in Table 2.

      Tube formation assay

      Tube formation assay was performed using BD BioCoat Angiogenesis System-Endothelial Cells Tube Formation Matrigel matrix 96-well plate (BD Biosciences Discovery Labware, Bedford, MA) according to the manufacturer's instructions. Briefly, isolated CD34+ CACs and HRECs were labeled with Qtracker 655 and Qtracker 525 (Invitrogen), respectively. Control or diabetic HRECs were mixed in a 4:1 ratio with either control or diabetic CD34+ cells, seeded into Matrigel matrix 96-well plate and incubated for 16 to 18 hours at 37°C (5% CO2). After incubation, wells were assessed for the presence of tube-like structures, and images were taken in ×10 magnifications using a Nikon TE2000 fluorescence microscope equipped with Photometrics CoolSNAP HQ2 camera. At least 3 different fields were randomly selected and captured to collect images for each well. Tube area and percentage of CD34+ incorporated into tubules were calculated using MetaMorph software system (Molecular Devices, Downingtown, PA). Statistics were performed on 3 independent wells per condition with minimum 3 images taken from each well.

      Quantitative real-time polymerase chain reaction

      Total RNA was extracted from HRECs, human CD34+ cells using QuickGene RNA (Fujifilm, Minato-Ku, Tokyo, Japan) or Qiagen RNeasy (Qiagen Inc, Valencia, CA) according to the manufacturer's instructions. NanoDrop 2000 (Thermo Scientific, IL) was used to determine total RNA concentration. Total RNA was reverse transcribed into complementary DNA using superscript III first-strand synthesis system (Invitrogen, Carlsbad, CA). Human gene-specific primers for ASM were used. Expression levels were normalized to human cyclophilin. Sequence of specific primers used is given in the following:
      Human ASM: caacctcgcgctgaagaa and tccaccatgtcatcctcaaa.
      Human cyclophilin: aaggtcccaaagacagcaga and cttgccaccagtgccattat.

      Enzyme-linked immunosorbent assay

      Blood samples were collected, centrifuged, and plasma was stored at −80°C. Samples were assayed for human ASM concentration using enzyme-linked immunosorbent assay kit (Cloud–Clone Corp, Houston, TX) according to the manufacturer's protocol.

      Statistical analyses

      Data are presented as mean ± standard error of the mean. Results were analyzed for statistical significance by the Student's t-test (GraphPad Prism 7; GraphPad Software, San Diego, CA). Significance was established at P < .05.

      Results

      ASM expression level is increased in HREC, CD34+ CACs, and blood plasma of diabetic donors

      To determine whether human diabetic tissues exhibited the same increase in ASM as we observed in animal models,
      • Tikhonenko M.
      • Lydic T.A.
      • Opreanu M.
      • et al.
      N-3 polyunsaturated fatty acids prevent diabetic retinopathy by inhibition of retinal vascular damage and enhanced endothelial progenitor cell reparative function.
      • Opreanu M.
      • Tikhonenko M.
      • Bozack S.
      • et al.
      The unconventional role of acid sphingomyelinase in regulation of retinal microangiopathy in diabetic human and animal models.
      we measured ASM expression level in human RECs, CD34+ CACs, and plasma samples in both diabetic and control donors. ASM expression level was significantly increased in all 3 tissue types in diabetic compared with control donors (Fig. 1A–C).
      Figure thumbnail gr1
      Figure 1Diabetes induced increase in ASM expression. Total RNA was isolated and the transcript level of ASM was analyzed by quantitative real-time polymerase chain reaction in (A) HRECs, (B) CD34+ cells, and (C) plasma from diabetic donors (n = 4–7) compared with control donors (n = 3–4). Data are means ± standard error of the mean. *P < .05, significantly different as determined by Student's t-test. ASM, acid sphingomyelinase; HRECs, human retinal endothelial cells.

      Diabetes induces decrease in HREC tube formation

      As shown above and previously demonstrated, HRECs isolated from diabetic donors have high ASM activity and expression level. To evaluate the effect of diabetes-induced increase in ASM on HRECs function, we performed tube formation assay to measure the ability of retinal endothelial cells to form blood vessel–like tubular structure. Tube formation by HRECs isolated from healthy control retinas was compared with cells isolated from retinas with signs of NPDR as determined by postmortem retinal imaging (Fig. 2A). A significant decrease in tube area was observed in HRECs from retinas with signs of NPDR compared with control HRECs (Fig. 2B).
      Figure thumbnail gr2
      Figure 2Diabetes impairs tube formation capacity of HRECs. (A) Postmortem imaging of human retina. Control retina with well-organized blood vessels (left), diabetic retina with signs of NPDR, intraretinal hemorrhages, and microaneurysms (right). (B) An in vitro tube formation assay was performed in control (n = 4) and diabetic (n = 7) HRECs using Matrigel matrix 96-well plate. Representative images of tube-like structures are shown. The cells were stained with Qtracker 525 (green), images were taken in ×10 magnification and total tube areas were calculated using MetaMorph software system. Quantification of tube area is shown on far right. Data are means ± standard error of the mean. *P < .05, significantly different as determined by Student's t-test. Scale bar = 50 μm. HRECs, human retinal endothelial cells; NPDR, nonproliferative diabetic retinopathy.

      Diabetes induced increase in ASM is associated with CD34+ CACs dysfunction

      To determine the role of ASM expression in diabetes-induced defect in CD34+ CACs function, we seeded CD34+ CACs isolated from both control (low ASM) and diabetic (high ASM) subjects with HRECs and examined whether the level of ASM expression in CACs affects their ability to incorporate into the endothelial tubes formed by the HRECs. Interestingly, CD34+ CACs seeded alone did not form tube-like structures, but they did incorporate into tubes formed by HRECs when co-cultured with retinal endothelial cells (Fig. 3C). Increased incorporation into tubes formed by diabetic HRECs was observed for the control CD34+ CACs (low ASM) compared with diabetic CACs (high ASM; Fig. 3B). As expected, control HRECs exhibited robust tube formation. Incorporation of CACs into control HREC tubes was not affected by the levels of ASM in CAC (Fig. 3A). These data demonstrate that high ASM expression levels in CD34+ CACs correlate with impaired incorporation ability, whereas CACs expressing lower levels of ASM display enhanced in vitro incorporation.
      Figure thumbnail gr3
      Figure 3Reduced incorporation of diabetic CD34+ CACs into diabetic HRECs tubes. Tube formation by HRECs (Qtracker 525, green) isolated from control (A) or diabetic (B) donors either without CACs (left panel), or co-incubated with control (middle panel) or diabetic (right panel) CACs (Qtracker 655, red) is shown. Quantification of percentage of CD34+ CACs incorporation into HRECs tubes is shown on far right. Data are means ± standard error of the mean (n = 4–7). ***P < .0001, significantly different from control as determined by Student's t-test; not significant at P > .05. Scale bar = 50 μm. (C) CD34+ CACs alone were not able to form tube-like structures (left panel), but incorporated into HREC tubes, forming tube-like structures, when co-cultured with HRECs (right 3 panels). CACs, circulating angiogenic cells; HRECs, human retinal endothelial cells.

      Diabetes induced increase in ASM is associated with loss of circadian release of CD34+ CACs

      We have previously demonstrated that normal diurnal pattern of CACs release from the bone marrow is critical for efficient repair of retinal vasculature in rodents.
      • Busik J.V.
      • Tikhonenko M.
      • Bhatwadekar A.
      • et al.
      Diabetic retinopathy is associated with bone marrow neuropathy and a depressed peripheral clock.
      Increase in ASM activity in CACs in diabetic animal models was associated with decreased membrane fluidity and impaired migration leading to increased CAC retention and loss of circadian release from the bone marrow.
      • Chakravarthy H.
      • Navitskaya S.
      • O'Reilly S.
      • et al.
      Role of acid sphingomyelinase in shifting the balance between proinflammatory and reparative bone marrow cells in diabetic retinopathy.
      We next determined the effect of diabetes on circadian release of CD34+ CACs in diabetic patients. Peripheral blood of type II diabetic individuals was collected every 2 hours for 24 hours and analyzed for the number of CD34+ CACs by flow cytometry and compared with control subjects. The dash line is the model fitted curve for individual subjects and bold curve is the fitted curve for population (Fig. 4A and B). In agreement with previous studies, healthy individuals had a peak of circulating CD34+ cells in the middle of the night, representing the rest phase for humans (Fig. 4A); however, this peak of CD34+ release was lost in type II diabetic subjects (Fig. 4B).
      Figure thumbnail gr4
      Figure 4Loss of circadian release of diabetic CD34+ CACs. Peripheral blood was collected every 2 hours for a total of 24 hours from (A) control (n = 4) and (B) diabetic (n = 8) subjects and was analyzed for the number of CD34+ CACs by flow cytometry. (A) In control subjects, there is a clear peak of circulating CD34+ CACs that occurred in the middle of the night. (B) Rhythmic CD34+ CACs release pattern was blunted in type II diabetic patients. The dash line is the model fitted curve for individual patients and bold curve is the fitted curve for population. CACs, circulating angiogenic cells.

      Discussion

      DR is a sight-threatening complication of diabetes with limited treatment strategies. Understanding the key molecular factors involved in the disease is important for developing therapeutic targets to prevent progression into ocular neovascularization and blindness. ASM is shown to be a key element in inflammatory signaling through ceramide-mediated signal transduction.
      • Gulbins E.
      • Grassmé H.
      Ceramide and cell death receptor clustering.
      • Marchesini N.
      • Hannun Y.A.
      Acid and neutral sphingomyelinases: roles and mechanisms of regulation.
      Diabetes-induced increase in ASM activity has been shown to modulate inflammatory response in mature retinal endothelial cells
      • Opreanu M.
      • Lydic T.A.
      • Reid G.E.
      • McSorley K.M.
      • Esselman W.J.
      • Busik J.V.
      Inhibition of cytokine signaling in human retinal endothelial cells through downregulation of sphingomyelinases by docosahexaenoic acid.
      ; however, there is no direct experimental evidence showing ASM effect on endothelial function. Here, we demonstrated that HRECs isolated from type II diabetic subjects with signs of NPDR had altered retinal endothelial cell function with impaired capacity to form tube-like structures when compared with control HRECs. The deficiency in tube formation was associated with increased expression of ASM in diabetic HRECs. This is consistent with previous studies showing ASM-mediated endothelial cell apoptosis in various tissues including retina, lungs and gastrointestinal tract,
      • Santana P.
      • Peña L.A.
      • Haimovitz-Friedman A.
      • et al.
      Acid sphingomyelinase-deficient human lymphoblasts and mice are defective in radiation-induced apoptosis.
      • Haimovitz-Friedman A.
      • Cordon-Cardo C.
      • Bayoumy S.
      • et al.
      Lipopolysaccharide induces disseminated endothelial apoptosis requiring ceramide generation.
      • Opreanu M.
      • Tikhonenko M.
      • Bozack S.
      • et al.
      The unconventional role of acid sphingomyelinase in regulation of retinal microangiopathy in diabetic human and animal models.
      • Paris F.
      • Fuks Z.
      • Kang A.
      • et al.
      Endothelial apoptosis as the primary lesion initiating intestinal radiation damage in mice.
      and ASM antiangiogenic effect in tumor treatment.
      • Garcia-barros A.M.
      • Paris F.
      • Cordon-cardo C.
      • Lyden D.
      Tumor response to radiotherapy regulated by endothelial cell apoptosis.
      Endothelium is the major source of ASM production in the body with endothelial cells synthesizing 20 times as much ASM as any other cell type
      • Marathe S.
      • Schissel S.L.
      • Yellin M.J.
      • et al.
      Human vascular endothelial cells are a rich and regulatable source of secretory sphingomyelinase.
      ; thus, it is not surprising that ASM plays a major role in endothelial cells function. In agreement with previous studies,
      • Marathe S.
      • Schissel S.L.
      • Yellin M.J.
      • et al.
      Human vascular endothelial cells are a rich and regulatable source of secretory sphingomyelinase.
      endothelial cells had very high ASM expression level, which was further increased in diabetes. Moreover, increased ASM level in plasma further reflects the increased production and secretion of ASM by activated endothelial cells.
      Retinal vascular repair and revascularization are aided by CACs.
      • Grant M.B.
      • May W.S.
      • Caballero S.
      • et al.
      Adult hematopoietic stem cells provide functional hemangioblast activity during retinal neovascularization.
      • Caballero S.
      • Sengupta N.
      • Afzal A.
      • et al.
      Ischemic vascular damage can be repaired by healthy, but not diabetic, endothelial progenitor cells.
      • Tamarat R.
      • Silvestre J.S.
      • Le Ricousse-Roussanne S.
      • et al.
      Impairment in ischemia-induced neovascularization in diabetes: bone marrow mononuclear cell dysfunction and therapeutic potential of placenta growth factor treatment.
      • Schatteman G.C.
      • Hanlon H.D.
      • Jiao C.
      • Dodds S.G.
      • Christy B.A.
      Blood-derived angioblasts accelerate blood-flow restoration in diabetic mice.
      • Asahara T.
      • Masuda H.
      • Takahashi T.
      • et al.
      Bone marrow origin of endothelial progenitor cells responsible for postnatal vasculogenesis in physiological and pathological neovascularization.
      • Asahara T.
      • Murohara T.
      • Sullivan A.
      • et al.
      Isolation of putative progenitor endothelial cells for angiogenesis.
      • Takahashi T.
      • Kalka C.
      • Masuda H.
      • Chen D.
      • Silver M.
      • et al.
      Ischemia- and cytokine-induced mobilization of bone marrow-derived endothelial progenitor cells for neovascularization.
      We examined the effect of diabetes-induced increase in ASM on the ability of CD34+ CACs to incorporate and thus help in repair of defective vascular-like tube structures formed by diabetic HRECs. We demonstrated that diabetic CD34+ CACs, with high ASM, showed minimal incorporation into the defective tubes formed by diabetic HRECs. Nondiabetic CD34+ CACs with low ASM showed robust incorporation. These results are in line with other studies showing that diabetic CACs are defective in proliferation, migration, adhesion, differentiation, and participation in vascular regeneration process.
      • Caballero S.
      • Sengupta N.
      • Afzal A.
      • et al.
      Ischemic vascular damage can be repaired by healthy, but not diabetic, endothelial progenitor cells.
      • Segal M.S.
      • Shah R.
      • Afzal A.
      • et al.
      Nitric oxide cytoskeletal-induced alterations reverse the endothelial progenitor cell migratory defect associated with diabetes.
      • Tamarat R.
      • Silvestre J.S.
      • Le Ricousse-Roussanne S.
      • et al.
      Impairment in ischemia-induced neovascularization in diabetes: bone marrow mononuclear cell dysfunction and therapeutic potential of placenta growth factor treatment.
      • Schatteman G.C.
      • Hanlon H.D.
      • Jiao C.
      • Dodds S.G.
      • Christy B.A.
      Blood-derived angioblasts accelerate blood-flow restoration in diabetic mice.
      • Tepper O.M.
      • Galiano R.D.
      • Capla J.M.
      • et al.
      Human endothelial progenitor cells from type II diabetics exhibit impaired proliferation, adhesion, and incorporation into vascular structures.
      • Chen Y.
      • Lin S.
      • Lin F.
      • Wu T.
      • Tsao C.
      High glucose impairs early and late endothelial progenitor cells by modifying nitric oxide – related but not oxidative stress – mediated mechanisms.
      Interestingly, no significant difference was observed between nondiabetic and diabetic CD34+ CACs incorporation into control HRECs. This is consistent with our previous studies demonstrating lack of incorporation of control CACs into healthy vasculature that does not require repair in nondiabetic.
      • Caballero S.
      • Sengupta N.
      • Afzal A.
      • et al.
      Ischemic vascular damage can be repaired by healthy, but not diabetic, endothelial progenitor cells.
      We have previously demonstrated that high level of ASM inversely correlates with migration and reparative capacity of CACs, with the inhibition of diabetes-induced ASM resulting in improved migration and retinal vascular regeneration in diabetic mouse model.
      • Tikhonenko M.
      • Lydic T.A.
      • Opreanu M.
      • et al.
      N-3 polyunsaturated fatty acids prevent diabetic retinopathy by inhibition of retinal vascular damage and enhanced endothelial progenitor cell reparative function.
      • Chakravarthy H.
      • Navitskaya S.
      • O'Reilly S.
      • et al.
      Role of acid sphingomyelinase in shifting the balance between proinflammatory and reparative bone marrow cells in diabetic retinopathy.
      In this study, we compared effect of ASM on functional capacity of healthy and diabetic CACs in human on control and diabetic HRECs. We revealed that the defective incorporation of diabetic CD34+ CACs was associated with high ASM. As previously shown, high ASM activity leads to accumulation of membrane ceramides. Accumulation of ceramide results in decreased membrane fluidity, cell rigidity, and defective migration, which can explain defective incorporation of diabetic CACs
      • Tikhonenko M.
      • Lydic T.A.
      • Opreanu M.
      • et al.
      N-3 polyunsaturated fatty acids prevent diabetic retinopathy by inhibition of retinal vascular damage and enhanced endothelial progenitor cell reparative function.
      • Chakravarthy H.
      • Navitskaya S.
      • O'Reilly S.
      • et al.
      Role of acid sphingomyelinase in shifting the balance between proinflammatory and reparative bone marrow cells in diabetic retinopathy.
      • Catapano E.R.
      • Arriaga L.R.
      • Espinosa G.
      • Monroy F.
      • Langevin D.
      • López-Montero I.
      Solid character of membrane ceramides: a surface rheology study of their mixtures with sphingomyelin.
      and likely supports their defective release from the bone marrow into the systemic circulation.
      Although several lines of evidence demonstrate that ASM expression is an important factor for progenitor cell release from the marrow, migration, proliferation, and homing to the injured vasculature; other factors beyond ASM activation are also known to be involved in diabetes-induced CAC dysfunction. These include bone marrow neuropathy and low level of neurotransmitters production, increase in TGF beta leading to decreased NO bioavailability and diminished expression of CXCR4.
      • Busik J.V.
      • Tikhonenko M.
      • Bhatwadekar A.
      • et al.
      Diabetic retinopathy is associated with bone marrow neuropathy and a depressed peripheral clock.
      • Bhatwadekar A.D.
      • Guerin E.P.
      • Jarajapu Y.P.R.
      • et al.
      Transient inhibition of transforming growth factor-β1 in human diabetic CD34+ cells enhances vascular reparative functions.
      These factors affect chemoattraction to SDF1 and lead to increase in stem cell quiescence in the bone marrow niche. In health, ASM works in concert with other factors to maintain optimal bone marrow stem cell production and release; however, activation of ASM along with other factors disrupts this balance in diabetes.
      • Busik J.V.
      • Tikhonenko M.
      • Bhatwadekar A.
      • et al.
      Diabetic retinopathy is associated with bone marrow neuropathy and a depressed peripheral clock.
      • Chakravarthy H.
      • Navitskaya S.
      • O'Reilly S.
      • et al.
      Role of acid sphingomyelinase in shifting the balance between proinflammatory and reparative bone marrow cells in diabetic retinopathy.
      • Chakravarthy H.
      • Beli E.
      • Navitskaya S.
      • et al.
      Imbalances in mobilization and activation of pro-inflammatory and vascular reparative bone marrow-derived cells in diabetic retinopathy.
      • Wang Q.
      • Navitskaya S.
      • Chakravarthy H.
      • et al.
      Dual anti-inflammatory and anti-angiogenic action of miR-15a in diabetic retinopathy.
      The physiological release of bone marrow progenitor cells including CD34+ CACs into the circulation is not constant, but follows circadian oscillations. These oscillations are regulated by sympathetic signaling to bone marrow stromal cells, which results in CXCL12 (SDF-1) down regulation and progenitor egress from the bone marrow; all these processes occur in circadian pattern under control of clock genes.
      • Méndez-Ferrer S.
      • Lucas D.
      • Battista M.
      • Frenette P.S.
      Haematopoietic stem cell release is regulated by circadian oscillations.
      Diabetic bone marrow neuropathy with disruption of circadian rhythm may contribute to endothelial progenitor cell dysfunction. Wang et al. have demonstrated that mutation in circadian gene Per2 leads to reduced endothelial cell progenitor mobilization and revascularization.
      • Wang C.Y.
      • Wen M.S.
      • Wang H.W.
      • et al.
      Increased vascular senescence and impaired endothelial progenitor cell function mediated by mutation of circadian gene Per2.
      We investigated whether circadian release of CD34+ CACs is altered in diabetic subjects. Peripheral blood was collected every 2 hours for 24 hours from both control and diabetic subjects. In agreement with previous studies,
      • Tsinkalovsky O.
      • Smaaland R.
      • Rosenlund B.
      • et al.
      Circadian variations in clock gene expression of human bone marrow CD34+ cells.
      • Mendez-Ferrer S.
      • Andrew C.
      • Merad M.
      • Frenett P.S.
      Circadian rhythms influence hematopoietic stem cells.
      • Abrahamsen J.F.
      • Smaaland R.
      • Sothern R.B.
      • Laerum O.D.
      Variation in cell yield and proliferative activity of positive selected human CD34+ bone marrow cells along the circadian time scale.
      normal rhythmic oscillations were observed in control subjects with a clear peak of circulating CD34+ CACs cells in the middle of the night (resting phase), optimal time of regeneration in humans. Similar to our observations in diabetic rat model,
      • Busik J.V.
      • Tikhonenko M.
      • Bhatwadekar A.
      • et al.
      Diabetic retinopathy is associated with bone marrow neuropathy and a depressed peripheral clock.
      this study revealed that circadian fluctuation of CD34+ CACs was disrupted with rhythmicity lost in diabetic individuals. Importantly, we have previously demonstrated that, similar to endothelial cells, the increase in ASM activity in CACs in diabetic animal models was associated with increased ceramide levels, decreased membrane fluidity, and impaired migration. This impairment in migration, combined with diminished sympathetic signaling to bone marrow may lead to increased CAC retention in the bone marrow and loss of circadian release of the progenitor cells as demonstrated in this study.

      Conclusion

      This study underscores the deleterious effect of high ASM levels on the vascular repair potential of both mature retinal endothelial cells and CACs in diabetes. Correcting this defect could treat vasodegeneration, enhancing vessel repair, and thus preventing progression into PDR stage.

      Acknowledgments

      Research was supported by MEAS Grant MICL02163 to JVB, NIH grants: RO1EY016077 to J.V.B., R01EY025383 to J.V.B. and M.B.G., EY012601-15, EY007739-25 to M.B.G., and Juvenile Diabetes Research Foundation (JDRF) Fellowship JDRF 3-PDF-2014-108-A-N to Q.W. The authors acknowledge National Research Disease Interchange and Michigan Eye-Bank for providing human retina tissue.
      Authors' contributions: N.K. designed the experiments, performed the co-culture study, and wrote the article. Y.Y. performed the diurnal CD34+ CAC release study, wrote and edited the article. T.S. performed human CD34+ CAC part of the study and edited the article. Q.W., H.C., C.H., E.B., and S.N. performed HREC isolation and culture, and CD34+ CAC isolation and co-culture experiments, and edited the article. M.B.G. contributed to conception, design, financial and administrative support, maintained IRB approval for research involving human subjects and edited the manuscript. J.V.B. designed the study, provided financial and administrative support, performed pilot experiments, and reviewed and edited the article. All authors have approved the final article.

      Disclosure

      The authors have no conflicts of interest to disclose.

      References

        • Hammes H.P.
        • Feng Y.
        • Pfister F.
        • Brownlee M.
        Diabetic retinopathy: targeting vasoregression.
        Diabetes. 2011; 60: 9-16
        • Lorenzi M.
        • Gerhardinger C.
        Early cellular and molecular changes induced by diabetes in the retina.
        Diabetologia. 2001; 44: 791-804
        • Wong K.
        Defining diabetic retinopathy severity.
        Diabet Retin Evid Based Manag. 2010; 10: 105-120
        • Grant M.B.
        • May W.S.
        • Caballero S.
        • et al.
        Adult hematopoietic stem cells provide functional hemangioblast activity during retinal neovascularization.
        Nat Med. 2002; 8: 607-612
        • Kocher A.A.
        • Schuster M.D.
        • Szabolcs M.J.
        • et al.
        Neovascularization of ischemic myocardium by human bone-marrow-derived angioblasts prevents cardiomyocyte apoptosis, reduces remodeling and improves cardiac function.
        Nat Med. 2001; 7: 430-436
        • Kalka C.
        • Masuda H.
        • Takahashi T.
        • et al.
        Transplantation of ex vivo expanded endothelial progenitor cells for therapeutic neovascularization.
        Proc Natl Acad Sci U S A. 2000; 97: 3422-3427
        • Busik J.V.
        • Tikhonenko M.
        • Bhatwadekar A.
        • et al.
        Diabetic retinopathy is associated with bone marrow neuropathy and a depressed peripheral clock.
        J Exp Med. 2009; 206: 2897-2906
        • Kusuyama T.
        • Omura T.
        • Nishiya D.
        • et al.
        Effects of treatment for diabetes mellitus on circulating vascular progenitor cells.
        J Pharmacol Sci. 2006; 102: 96-102
        • Fadini G.P.
        • Pucci L.
        • Vanacore R.
        • et al.
        Glucose tolerance is negatively associated with circulating progenitor cell levels.
        Diabetologia. 2007; 50: 2156-2163
        • Hazra S.
        • Jarajapu Y.P.R.
        • Stepps V.
        • et al.
        Long-term type 1 diabetes influences haematopoietic stem cells by reducing vascular repair potential and increasing inflammatory monocyte generation in a murine model.
        Diabetologia. 2013; 56: 644-653
        • Loomans C.J.
        • de Koning E.J.
        • Staal F.J.
        • et al.
        Endothelial progenitor cell dysfunction: a novel concept in the pathogenesis of vascular complications of type 1 diabetes.
        Diabetes. 2004; 53: 195-199
        • Loomans C.
        • van Haperen R.
        • Duijs J.M.
        • et al.
        Differentiation of bone marrow-derived endothelial progenitor cells is shifted into a proinflammatory phenotype by hyperglycemia.
        Mol Med. 2009; 15: 152-159
        • Caballero S.
        • Sengupta N.
        • Afzal A.
        • et al.
        Ischemic vascular damage can be repaired by healthy, but not diabetic, endothelial progenitor cells.
        Diabetes. 2007; 56: 960-967
        • Segal M.S.
        • Shah R.
        • Afzal A.
        • et al.
        Nitric oxide cytoskeletal-induced alterations reverse the endothelial progenitor cell migratory defect associated with diabetes.
        Diabetes. 2006; 55: 102-109
        • Tikhonenko M.
        • Lydic T.A.
        • Opreanu M.
        • et al.
        N-3 polyunsaturated fatty acids prevent diabetic retinopathy by inhibition of retinal vascular damage and enhanced endothelial progenitor cell reparative function.
        PLoS One. 2013; 8: 1-10
        • Tamarat R.
        • Silvestre J.S.
        • Le Ricousse-Roussanne S.
        • et al.
        Impairment in ischemia-induced neovascularization in diabetes: bone marrow mononuclear cell dysfunction and therapeutic potential of placenta growth factor treatment.
        Am J Pathol. 2004; 164: 457-466
        • Kern T.S.
        Contributions of inflammatory processes to the development of the early stages of diabetic retinopathy.
        Exp Diabetes Res. 2007; 2007: 95103
        • Kowluru R.A.
        Role of interleukin-1β in the pathogenesis of diabetic retinopathy.
        Br J Ophthalmol. 2004; 88: 1343-1347
        • Kowluru R.A.
        • Odenbach S.
        Role of interleukin-1β in the development of retinopathy in rats: effect of antioxidants.
        Invest Ophthalmol Vis Sci. 2004; 45: 4161-4166
        • Joussen A.M.
        • Poulaki V.
        • Mitsiades N.
        • et al.
        Nonsteroidal anti-inflammatory drugs prevent early diabetic retinopathy via TNF-alpha suppression.
        FASEB J. 2002; 16: 438-440
        • Joussen A.M.
        • Doehmen S.
        • Le M.L.
        • et al.
        TNF-alpha mediated apoptosis plays an important role in the development of early diabetic retinopathy and long-term histopathological alterations.
        Mol Vis. 2009; 15: 1418-1428
        • Demircan N.
        • Safran B.G.
        • Soylu M.
        • Ozcan A.A.
        • Sizmaz S.
        Determination of vitreous interleukin-1 (IL-1) and tumour necrosis factor (TNF) levels in proliferative diabetic retinopathy.
        Eye (Lond). 2006; 20: 1366-1369
        • Joussen A.M.
        • Poulaki V.
        • Qin W.
        • et al.
        Retinal vascular endothelial growth factor induces intercellular adhesion molecule-1 and endothelial nitric oxide synthase expression and initiates early diabetic retinal leukocyte adhesion in vivo.
        Am J Pathol. 2002; 160: 501-509
        • Adamiec-Mroczek J.
        • Oficjalska-Młyńczak J.
        Assessment of selected adhesion molecule and proinflammatory cytokine levels in the vitreous body of patients with type 2 diabetes–role of the inflammatory-immune process in the pathogenesis of proliferative diabetic retinopathy.
        Graefes Arch Clin Exp Ophthalmol. 2008; 246: 1665-1670
        • Miyamoto K.
        • Khosrof S.
        • Bursell S.E.
        • et al.
        Prevention of leukostasis and vascular leakage in streptozotocin-induced diabetic retinopathy via intercellular adhesion molecule-1 inhibition.
        Proc Natl Acad Sci U S A. 1999; 96: 10836-10841
        • Semeraro F.
        • Cancarini A.
        • Dell’Omo R.
        • Rezzola S.
        • Romano M.R.
        • Costagliola C.
        Diabetic retinopathy: vascular and inflammatory disease.
        J Diabetes Res. 2015; 2015: 1-16
        • Liu P.
        • Anderson R.G.
        Compartmentalized production of ceramide at the cell surface.
        J Biol Chem. 1995; 270: 27179-27185
        • Mathias S.
        • Younes A.
        • Kan C.
        • et al.
        Activation of the sphingomyelin signaling pathway in intact EL4 cells and in a cell-free system by IL-1β.
        Science. 1993; 259: 519-522
        • Schutze S.
        • Potthoff K.
        • Machleidt T.
        TNF activates phospholipase sphingomyelin NF-KB by phosphatidylcholine-specific C-induced “acidic” breakdown.
        Cell. 1992; 71: 765-776
        • Santana P.
        • Peña L.A.
        • Haimovitz-Friedman A.
        • et al.
        Acid sphingomyelinase-deficient human lymphoblasts and mice are defective in radiation-induced apoptosis.
        Cell. 1996; 86: 189-199
        • Haimovitz-Friedman A.
        • Cordon-Cardo C.
        • Bayoumy S.
        • et al.
        Lipopolysaccharide induces disseminated endothelial apoptosis requiring ceramide generation.
        J Exp Med. 1997; 186: 1831-1841
        • Marathe S.
        • Schissel S.L.
        • Yellin M.J.
        • et al.
        Human vascular endothelial cells are a rich and regulatable source of secretory sphingomyelinase.
        J Biol Chem. 1998; 273: 4081-4088
        • Opreanu M.
        • Tikhonenko M.
        • Bozack S.
        • et al.
        The unconventional role of acid sphingomyelinase in regulation of retinal microangiopathy in diabetic human and animal models.
        Diabetes. 2011; 60: 2370-2378
        • Chakravarthy H.
        • Navitskaya S.
        • O'Reilly S.
        • et al.
        Role of acid sphingomyelinase in shifting the balance between proinflammatory and reparative bone marrow cells in diabetic retinopathy.
        Stem Cells. 2016; 34: 972-983
        • Bhatwadekar A.D.
        • Yan Y.
        • Qi X.
        • et al.
        Per2 mutation recapitulates the vascular phenotype of diabetes in the retina and bone marrow.
        Diabetes. 2013; 62: 273-282
        • Bhatwadekar A.D.
        • Yan Y.
        • Stepps V.
        • et al.
        MiR-92a corrects CD34+ cell dysfunction in diabetes by modulating core circadian genes involved in progenitor differentiation.
        Diabetes. 2015; 64: 4226-4237
        • Roy S.
        • Sala R.
        • Cagliero E.
        • Lorenzi M.
        Overexpression of fibronectin induced by diabetes or high glucose: phenomenon with a memory.
        Proc Natl Acad Sci U S A. 1990; 87: 404-408
        • Grant M.B.
        • Caballero S.
        • Tarnuzzer R.W.
        • et al.
        Matrix metalloproteinase expression in human retinal microvascular cells.
        Diabetes. 1998; 47: 1311-1317
        • Kowluru R.A.
        • Santos J.M.
        • Mishra M.
        Epigenetic modifications and diabetic retinopathy.
        Biomed Res Int. 2013; 2013: 635284
        • Busik J.V.
        • Mohr S.
        • Grant M.B.
        Hyperglycemia-induced reactive oxygen species toxicity to endothelial cells is dependent on paracrine mediators.
        Diabetes. 2008; 57: 1952-1965
        • Gulbins E.
        • Grassmé H.
        Ceramide and cell death receptor clustering.
        Biochim Biophys Acta. 2002; 1585: 139-145
        • Marchesini N.
        • Hannun Y.A.
        Acid and neutral sphingomyelinases: roles and mechanisms of regulation.
        Biochem Cell Biol. 2004; 82: 27-44
        • Opreanu M.
        • Lydic T.A.
        • Reid G.E.
        • McSorley K.M.
        • Esselman W.J.
        • Busik J.V.
        Inhibition of cytokine signaling in human retinal endothelial cells through downregulation of sphingomyelinases by docosahexaenoic acid.
        Invest Ophthalmol Vis Sci. 2010; 51: 3253-3263
        • Paris F.
        • Fuks Z.
        • Kang A.
        • et al.
        Endothelial apoptosis as the primary lesion initiating intestinal radiation damage in mice.
        Science. 2001; 293: 293-297
        • Garcia-barros A.M.
        • Paris F.
        • Cordon-cardo C.
        • Lyden D.
        Tumor response to radiotherapy regulated by endothelial cell apoptosis.
        Science. 2003; 300: 1155-1159
        • Schatteman G.C.
        • Hanlon H.D.
        • Jiao C.
        • Dodds S.G.
        • Christy B.A.
        Blood-derived angioblasts accelerate blood-flow restoration in diabetic mice.
        J Clin Invest. 2000; 106: 571-578
        • Asahara T.
        • Masuda H.
        • Takahashi T.
        • et al.
        Bone marrow origin of endothelial progenitor cells responsible for postnatal vasculogenesis in physiological and pathological neovascularization.
        Circ Res. 1999; 85: 221-228
        • Asahara T.
        • Murohara T.
        • Sullivan A.
        • et al.
        Isolation of putative progenitor endothelial cells for angiogenesis.
        Science. 1997; 275: 964-967
        • Takahashi T.
        • Kalka C.
        • Masuda H.
        • Chen D.
        • Silver M.
        • et al.
        Ischemia- and cytokine-induced mobilization of bone marrow-derived endothelial progenitor cells for neovascularization.
        Nat Med. 1999; 5: 434-438
        • Tepper O.M.
        • Galiano R.D.
        • Capla J.M.
        • et al.
        Human endothelial progenitor cells from type II diabetics exhibit impaired proliferation, adhesion, and incorporation into vascular structures.
        Circulation. 2002; 106: 2781-2786
        • Chen Y.
        • Lin S.
        • Lin F.
        • Wu T.
        • Tsao C.
        High glucose impairs early and late endothelial progenitor cells by modifying nitric oxide – related but not oxidative stress – mediated mechanisms.
        Diabetes. 2007; 56: 1559-1568
        • Catapano E.R.
        • Arriaga L.R.
        • Espinosa G.
        • Monroy F.
        • Langevin D.
        • López-Montero I.
        Solid character of membrane ceramides: a surface rheology study of their mixtures with sphingomyelin.
        Biophys J. 2011; 101: 2721-2730
        • Bhatwadekar A.D.
        • Guerin E.P.
        • Jarajapu Y.P.R.
        • et al.
        Transient inhibition of transforming growth factor-β1 in human diabetic CD34+ cells enhances vascular reparative functions.
        Diabetes. 2010; 59: 2010-2019
        • Chakravarthy H.
        • Beli E.
        • Navitskaya S.
        • et al.
        Imbalances in mobilization and activation of pro-inflammatory and vascular reparative bone marrow-derived cells in diabetic retinopathy.
        PLoS One. 2016; 11: 1-21
        • Wang Q.
        • Navitskaya S.
        • Chakravarthy H.
        • et al.
        Dual anti-inflammatory and anti-angiogenic action of miR-15a in diabetic retinopathy.
        EBioMedicine. 2016; 11: 138-150
        • Méndez-Ferrer S.
        • Lucas D.
        • Battista M.
        • Frenette P.S.
        Haematopoietic stem cell release is regulated by circadian oscillations.
        Nature. 2008; 452: 442-447
        • Wang C.Y.
        • Wen M.S.
        • Wang H.W.
        • et al.
        Increased vascular senescence and impaired endothelial progenitor cell function mediated by mutation of circadian gene Per2.
        Circulation. 2008; 118: 2166-2173
        • Tsinkalovsky O.
        • Smaaland R.
        • Rosenlund B.
        • et al.
        Circadian variations in clock gene expression of human bone marrow CD34+ cells.
        J Biol Rhythms. 2007; 22: 140-150
        • Mendez-Ferrer S.
        • Andrew C.
        • Merad M.
        • Frenett P.S.
        Circadian rhythms influence hematopoietic stem cells.
        Curr Opin Hematol. 2009; 16: 235-242
        • Abrahamsen J.F.
        • Smaaland R.
        • Sothern R.B.
        • Laerum O.D.
        Variation in cell yield and proliferative activity of positive selected human CD34+ bone marrow cells along the circadian time scale.
        Eur J Haematol. 1998; 60: 7-15